MLST-ID for Clavibacter

Using the packages ape, phangorn, and poppr we developed a genotype identification tool for Clavibacter populations. The regions we obtained (in FASTA format) are divided in two:

  1. Housekeeping Genes
  2. Virulence Genes

This genotyping webapp permits the identification of a query strain with any of the mentioned loci or a concatenated matrix of the housekeeping genes, virulence genes or both datasets.

How to run MLST-ID?

  1. Select the Loci database of interest
  2. Copy and paste one or more FASTA queries to the text frame using the gene name in the ">". (e.g. >DnaA) (You can use Notepad, Textedit or Textwrangler to open FASTA files)
  3. Select one of the genetic distances (read the ape page on distances for more information) and set a seed value (any number).
  4. Select the type of analysis and the number of boostraps.
  5. Instant profit.

How to use a concatenated database?

MLST-ID for Clavibacter uses single gene information as mentioned before, but also has the capacity to use a concatenated matrix with ANY of the genes. Just add the sequence with the gene name as header and run.

>DnaA CGCGGCAGTCGCCGTCGCCGAGGCGCCGGCCAAGGCATACAACCCTCTCTTCATCTACGGCGACTCGGGCCTCGGCAAGACCCACCTGCTGCACGCCATCGGCCACTACGCCATCAGCCTCTACCCCGGCATCCGCGTGCGGTACGTGAGCTCGGAGGAGTTCACCAACGACTTCATCAACTCGATCGCGAACAACCGGTCCTCGCTGTTCCAGTCGCGCTACCGCGACAACGACATCCTGCTGATCGACGACATCCAGTTCCTCCAGGGCAAGGACTCCACGCAGGAGGCCTTCTTCCACACCTTCAACACTCTGCACGACCACAACAAGCAGGTCGTCATCACGAGCGACCTGCCGCCGAAGCACCTCACGGGCTTCGAGGACCGCATGCGCTCGCGCTTCGAGTGGGGCCTCATCACCGACGTGCAGGCGCCCGACCTCGAGACGCGCATCGCGATCCTCCGGAAGAAGGCGCAGAGCGAGAAGCTGCAGGTGCCGGACGACATCCTCGAGTACATGGCCACCAAGGTCACGTCGAACATCCGCGAGCTCGAGGGCACGTTGATCCGCGTGACGGCGTTCGCGAGCCTCAACAAGACGCCCGTCGACCTCGCGCTCGTGCAGACGGTCCTGAAGGACCTGATCACGCTGGACGAGGACAACGTCATCGCGCCGGTCGACATCATCAACCACACCGCGGCCTACTTCAAGCTCACCGTCGACGACCTCTACGGCTCGTCCCGGTCCCAGGCCGTGGCCACCGCACGCCAGATCGCCATGTACCTCTGCCGCGAGCTGACCAACCTCTCGCTGCCCAAGATCGGCCAGCTGT >GyrB TTCGACTACGACACCCTCCGCGCGCGCTTCCAGCAGATGGCGTTCCTCAACAAGGGCCTGGCGCTCACGCTGCACGACGAGCGCGAGGTGGACGGCGCCGAGCACCGCACCGAGAAGTTCCTCTACGAGCGGGGCCTCGTCGACTACGTGGAGCACCTCGTGAAGGCGAAGAAGACCGAGGTCGTCAACGCCGACGTCATCGCCTTCGAGTCCGAGGACACGGTCAAGAAGATCAGCCTCGAGGTCGCGATGCAGTGGACCACCTCCTACACGGAGAGCGTCCACACCTACGCGAACACCATCAACACGCACGAGGGCGGCACGCACGAGGAGGGGTTCCGCGCGGCGCTCACCACGCTCGTCAACCGCTACGCGCGCGAGAACAAGCTGCTCCGCGAGAAGGACGAGAACCTCACGGGCGACGACGTCCGCGAGGGCCTCACGGCCGTCATCTCGGTGAAGCTCGGCGAGCCGCAGTTCGAGGGCCAGACCAAGACCAAG

All genes

Housekeeping gene map

Housekeeping genes:

Housekeeping gene map

Virulence genes:

Housekeeping gene map