MLST-ID Tutorial:

FASTA examples

Select a gene, copy and paste


DnaA

>DnaA
CGCGGCAGTCGCCGTCGCCGAGGCGCCGGCCAAGGCATACAACCCTCTCTTCATCTACGGCGACTCGGGCCTCGGCAAGACCCACCTGCTGCACGCCATCGGCCACTACGCCATCAGCCTCTACCCCGGCATCCGCGTGCGGTACGTGAGCTCGGAGGAGTTCACCAACGACTTCATCAACTCGATCGCGAACAACCGGTCCTCGCTGTTCCAGTCGCGCTACCGCGACAACGACATCCTGCTGATCGACGACATCCAGTTCCTCCAGGGCAAGGACTCCACGCAGGAGGCCTTCTTCCACACCTTCAACACTCTGCACGACCACAACAAGCAGGTCGTCATCACGAGCGACCTGCCGCCGAAGCACCTCACGGGCTTCGAGGACCGCATGCGCTCGCGCTTCGAGTGGGGCCTCATCACCGACGTGCAGGCGCCCGACCTCGAGACGCGCATCGCGATCCTCCGGAAGAAGGCGCAGAGCGAGAAGCTGCAGGTGCCGGACGACATCCTCGAGTACATGGCCACCAAGGTCACGTCGAACATCCGCGAGCTCGAGGGCACGTTGATCCGCGTGACGGCGTTCGCGAGCCTCAACAAGACGCCCGTCGACCTCGCGCTCGTGCAGACGGTCCTGAAGGACCTGATCACGCTGGACGAGGACAACGTCATCGCGCCGGTCGACATCATCAACCACACCGCGGCCTACTTCAAGCTCACCGTCGACGACCTCTACGGCTCGTCCCGGTCCCAGGCCGTGGCCACCGCACGCCAGATCGCCATGTACCTCTGCCGCGAGCTGACCAACCTCTCGCTGCCCAAGATCGGCCAGCTGT
                

GyrB

>GyrB
TTCGACTACGACACCCTCCGCGCGCGCTTCCAGCAGATGGCGTTCCTCAACAAGGGCCTGGCGCTCACGCTGCACGACGAGCGCGAGGTGGACGGCGCCGAGCACCGCACCGAGAAGTTCCTCTACGAGCGGGGCCTCGTCGACTACGTGGAGCACCTCGTGAAGGCGAAGAAGACCGAGGTCGTCAACGCCGACGTCATCGCCTTCGAGTCCGAGGACACGGTCAAGAAGATCAGCCTCGAGGTCGCGATGCAGTGGACCACCTCCTACACGGAGAGCGTCCACACCTACGCGAACACCATCAACACGCACGAGGGCGGCACGCACGAGGAGGGGTTCCGCGCGGCGCTCACCACGCTCGTCAACCGCTACGCGCGCGAGAACAAGCTGCTCCGCGAGAAGGACGAGAACCTCACGGGCGACGACGTCCGCGAGGGCCTCACGGCCGTCATCTCGGTGAAGCTCGGCGAGCCGCAGTTCGAGGGCCAGACCAAGACCAAG
                

KdpA

>KdpA
GTCTCGGCGGCGGTCGGCATCGCGGTGGCCATCGCGCTCGTCCGCGGCTTCGCCCGCACCCGCACCGGCACGATCGGCAACCTCTGGGTCGACCTGATCCGCGGATCCCTCCGCCTGCTGCTCCCCCTCTCGCTCGTCACCGCAGTGATCCTCATCGCCGGCGGCGTGATCCAGAACTTCGCCGGCTTCCAGGACGTGGCCACCATCACGGGCGGCACGCAGACGATCCCGGGCGGTCCGGTGGCCTCGCAGGAGGCCATCAAGATGCTCGGCACGAACGGCGGCGGGTTCTTCAACGCGAACTCCGCGCACCCGTTCGAGGACCCGACCGCCTGGACGAGCGCGTTCCAGGTGATCCTGATGCTCGCGATCCCGTTCTCGCTCCCCCGCACCTTCGGGAAGATGGTCGGCGACACCCGCCAGGGCACGGCGATCGTGGCCGTCATGGCGACGATCTTCGTGGTCTCCTTCACCGCGCTCACGATCTTCGAGCTGAACGGCCAGGGCACGGCGCCGATGGCCGCCGGCGGCGCGATGGAGGGCAAGGAGCAGCGCTTCGGCATCATCGCCTCGACGCTGTTCGGATCCGCGTCGACGCTCACCTCGACGGGCGCGGTCAACTCGATGCACGACTCGTACACGGCGCTCGGCGGCATGATGCCGATGATCA
                

LigA

>LigA
CTGAATGCCCGGCAGCTGGAGGTGGGGGAGCGCGTCTTCGCGAACCCGCGGAACGCCGCCGCGGGATCCCTGCGCCAGAAGGAGGAGGGCAAGAGCCCGGCGCGCCTCGAGCTCATGCGCGCGCGAATACGCCGCCTCCGCATGCTCGTGCACGGCATCGGCGCATGGCCCGTCCGCGAGCTGGCGAGCGACGCCCATGTGTCCGCGCAGTCCGAGGTGTACGGGCTGCTGGCCGGCTGGGGCCTCCCCATCTCCACGCACTTCCGCGTGTTCGACGACATCTCCGAGGTCACGGAGTTCGTGCGGCGGCACGGCGCGCACCGCGCCGAGGTCGAGCACCAGATCGACGGCATCGTCGTCAAGGTCGACGACCTGGGGCTCCACGAGGAGCTCGGCGCCACGAGCCGCGCCCCGCGGTGGGCGACCGCGTACAAGTACCCGCCCGAGGAGGTCAACACGACGCTCCTCGACATCGTCGTGAGCGTCGGCCGCACGGGTCGCGCCACGCCGTTCGCCGTCATGGA
                

CelA

>CelA
AGATCGTCGTGACCGCATTTCCTCTCACGCCTCGGGGGCACATTGCGCCTTTTGGGCGGTTCGAGGTCCTCGGCTCTGAGGGGGCTACGCCGGCGGCGCACAACATACCTCAGGGAACTAACCGGATGAGCACTGTTTCGGGCGTGAGGAGTGCGTGCGAAAGGCGTCTGTGGAAGTGGTTTTCAGTGCGGCCGGATGGCTTCCCTACGATCCATATATGACATTTCGCCAAGTTCGTGCATCCTTAGTGCTTCGGCTCGTCCTTCTCCTTGCGTTGGTGGTCGGCACCACGTCCGCCGCATTCGCTGCGCCTGTCTCAGCCGCCACCGTAGCGGGGCCCGTTGCGGTGGCCTCATCGCCTGGATGGCTGCATACGGCGGGCGGGAAGATCGTCACCGCCTCCGGTGCTCCGTACACGATCCGTGGCATCGCTTGGTTTGGCATGGAGACGTCGTCGTGCGCGCCGCATGGCCTGGACACCATCACCCTCGCGGGCGGTATGCAGCACATCAAGCAGATGGGGTTCACGACCGTGCGGTTGCCCTTCTCGAACCAGTGCCTCGCCGCGTCCGGCGTCACGGGTGTCAGTGCGGACCCGTCACTCGCCGGGCTCACGCCGCTGCAGGTCATGGACCACGTCGTCGCGTCGGCGAAGAGCGCCGGTCTTGACGTGATCCTCGACCAGCACCGGCCGGACTCGGGCGGCCAGTCTGAGCTCTGGTACACATCGCAGTATCCGGAGTCGCGGTGGATCTCCGACTGGAGGATGCTCGCAAAGCGCTACGCGTCCGACCCCGCCGTCATCGGTGTCGACCTGCACAACGAGCCGCACGGTGCGGCGACCTGGGGTACCGGGGCGGCCACCACTGACTGGCGGGCAGCGGCCGAGCGTGGCGGGAATGCGGTCCTCGCCGAGAACCCGAACCTCCTCGTGCTCGTGGAGGGCATCGACCACGAGGCCGACGGATCTGGCACCTGGTGGGGCGGCGCGCTCGGGTTGGTAGGCAATGCACCTGTGCGGCTGTCGGTCGCGAATCGCGTCGTCTACTCCCCGCATGACTACCCCTCGACCATTTACGGCCAGTCATGGTTCTCCGCATCAAACT
                

NagA

>NagA
TAGCTCCTTCAGCCGAAGGGGTTTTCTTACCGCCGCGGCCTCCATCGGCGCTGCGGTCGCCGTGCAGGCGACGGAGGAAGGGGGCGACGCAGCTCGTGCATCGACAGCGAACATTGATGTCGTCCGCCTGGTCCAGGGCATGTCGCTCGAGGATAAGGTCGCACAGTTGTTCGTCCTCGCGGTCTCCGGCCGTACGGCCGACACCGCAGACCCCGCGGCTGTGACGGCCAATCGCGCGGCTTACGGCGTCGCTACTCCGGCGGAAGTCGTCGCCCGGCACCGGCCTGGCGGCATCATCTACTTCGCCGGAGAGAAGGACAACCTCGTCGACCCGCGGCAGATCGCGCGGCTGTCCGGCGACTTGCAGCGTGCGTCACAGGGAGCGGGCCGAATCCCTCTCCTCGTCTCCACGGATCAAGAGCAGGGAGGCTATGTCGTGCGCGCTCCGTGCACGTTGCTTCCCGGACAGATGGGATTGGCCTCGAGCCCGAGTTCCTCTGCCGACGTTCGCGCGGTGGCGACCATCACGCGGGACGAGCTCCTCGCGATGGGCATCAACCAGGCCTTCGCGCCGGTGGTGGATGTGGCCTCCAACCCCGCAAACCCAATCATCCACGTGCGCTCCTTCGGGGACGATCCGGACCGGGTTGCTTCGCTCGCGCAGTCCCAGATCGGCACGTTCCAGAAGCGGCAGGGGATCGTGGCTGCGGCAAAGCACTTCCCCGGTCACGGCGCCACCGACACTGATAGCCACACCGGCCTTCCCGTA
                

TomA

>TomA
CAGGTTCTCGTTGATGAAGAGCTTCGCGTCCGGGTCGGCTGCTCGCGCGATGTGGAAGGCGTCAGCGATGTACCCGGGACCGAGGACCTTAAAGAAGGTGGTGCTTTGAAGCGTCGTACCTTGCGACTCGAGCGCTTCAGAGACAACGTCCCACCGATCGATCCTTCCGTCGTAACGCTCCATCACAGTGGTGAAGTGCTCTGTCATCGCCGCCCGCATCTCGCCGGCATCCGTGATCGAGGTCACGTACTCCGGATCGCAGCAGCTGGAGATCAGACCATGGCCCTTTACCGCCATGTCGTGCTCTTCGGCGAAGGCGACCAGTCGGTCAAGCCCAGCGAAGTCGTACACACCCTCTTCGGGTTGCGTGAAGGCCCATTTCATCTCGTTCTCGGGAGAAAGGCCATTGAACTGTTCGGCGAGGGTGTCGGCGAACCGCGGATCGGTCAGGTAGTTCGACGGGCGGTCGTCCTTCGTCCACTCCGCGGCCTTGATCGAGCCGGATCCGA
                

SdhA

>SdhA
TACCGCTCGCGCAGGTCGGCGATCACCTTGGTGACCTCGATCAGCGTGTCCTCGGTGCGGAACACCTGGGCGTTGCGGTCCATGGACTCCTGCAGCTCGCGACGCAGCGTCGAGATCCGCTCGGTGCCGTTGGAGTTGCGCGCGCCCTCGACGAGGCCCTTCACGAAGTCGGCCGCGTCGGCGGGCAGCGGCGTGAAGTCGACCGTCTTGACGTACTCGGCGGCGTAGTTGCCCGCGCGCTTGCCGAAGACGTTGATGTCGAGGAGCGAGTTGGTGCCGAGGCGGTTGGAACCGTGCACCGAGACGCACGCGCACTCGCCGGCCGCGTAGAGGCCCGGCACGACGGTCGTGTTGTCGGAGAGGACCTCGGCCTTGATGTTCGTGGGGATGCCGCCCATCGCGTAGTGCGCGGTCGGCAGCACGGGCACGGGCTCCGTGTAGGGCTCGACGCCGAGGTACGTGCGCGCGAACTCCGTGATGTCAGGGAGCTTCGCGTCGATGACGGCGGGCTCGAGGTGCGTGATGTCGAGGTAGACGTAGTCCTTGTTCGGTCCCGCGCCGCGGCCCTCGCGGATCTCGGTGGCCATGCACCGGGCGACGATGTCACGCGGCGCGAGGTCCTTGATGGTGGGGGCGTACCGCTCCATGAAGCGCTCGCCCTCGCTGTTGCGGAGGATCGCGCCCTCGCCACGTGCCGCCTCCGACAGGAGGATGCCGAGGCCGGCGAGGCCGGTCGGGTGGAACTGGAA